CHITARRA DIDATTICA ONSTAGE RECnMIX RITMI NEWS
Reaktor madness - DNA Sequencer
di [user #25769] - pubblicato il

Il DNA è una delle più grandi meraviglie della vita: quattro semplici basi che, disposte in sequenza, contengono tutte le informazioni necessarie allo sviluppo ed al corretto funzionamento degli esseri viventi. Renderemo quindi omaggio alla vita sfruttando le sequenze genetiche come note che, tramite una semplice sostituzione, daranno luce a nuove idee musicali.

Il cuore del nostro sequencer genetico sarà una tabella di Reaktor: i moduli tabella sono utilissimi per memorizzare e reintrodurre una serie di informazioni che possono essere interpretati, nel nostro caso, come segnali di controllo. Essendo bidimensionali avremo a disposizione un asse X per le righe ed un asse Y per le colonne.

Iniziamo la costruzione di questo Ensemble partendo da un Instrument vuoto e, una volta eliminato tutto ciò che troviamo al suo interno e configurato il numero di voci ad 1, aggiungiamo una Event Table dal menu Event Processing. Lasciamo, per ora, i parametri di default ed aggiungiamo un Global Clock dal menu Macro → Classic Modular → Sequencer. Questo ci darà il segnale di clock per il nostro sequencer. Colleghiamo l'uscita Pos del clock agli ingressi RX, R ed XO dell'Event Table.

Questi ingressi della tabella servono rispettivamente ad indicare la posizione di lettura della riga, l'esecuzione della lettura e la posizione della riga nella visualizzazione grafica. Ci sarà molto utile successivamente per visualizzare la sequenza genetica. A questo punto dobbiamo decidere cosa fare dei dati che andremo a leggere: l'idea è quella che ad ogni base corrisponda una nota da far uscire fuori. I valori che andremo ad interpretare saranno compresi tra 0 e 3, nell'ordine di Adimina, Timina, Guanina e Citosina. Per discernere i dati dalla tabella abbiamo bisogno di un modulo Distributor/Panner dal menu Built-In Module → Signal Path al cui ingresso Pos andremo a collegare l'uscita della nostra tabella. Colleghiamo l'uscita Clk G, dal Global Clock, all'ingresso In del Distributor in modo da poter attivare successivamente i segnali di gate per le nostre note. Andiamo nelle proprietà del Distributor e settiamo il parametro Curve su None: in questo modo tutte le note verranno suonate correttamente.

Ora la parte tediosa. Creiamo una Macro vuota – che chiameremo Midi – ed aggiungiamo, al suo interno, quattro ingressi etichettandoli da G1 a G4. Fatto questo aggiungiamo: un modulo Note Pitch/Gate dal menu Midi Out; un moltiplicatore; un sommatore; una lista, un bottone ed una manopola dal menu Panel. Rinominiamo la lista in “Note 1”, il bottone in M e la manopola in Transpose. Ora facciamo un bel respiro ed iniziamo a popolare la lista “Note 1”: dovrà contenere TUTTE le note MIDI partendo da 0 (C-1) fino a 127 (G9). Per “velocizzare”, clicchiamo sul pulsante Append (nelle proprietà del modulo) finché il riquadro Number non arriverà a 127 e, di seguito, andiamo a rinominare tutte le righe.

Il pulsante M sarà per mettere in muto il canale, ergo andremo ad inserire 0 come valore massimo ed 1 come minimo nelle sue proprietà. Riguardo Transpose, faremo in modo di poterci spostare fino a due ottave per estremità della manopola inserendo 24 come valore massimo e -24 come minimo, con Step Size di 1. Colleghiamo “Note 1” e Transpose al sommatore, G1 ed M al moltiplicatore e le rispettive uscite agli ingressi P e G del modulo MIDI Note.

Selezioniamo “Note 1”, il pulsante M, il sommatore, il moltiplicatore, il modulo MIDI Note e duplichiamoli fino ad avere quattro sezioni distinte. Rinominiamo le varie liste in “Note 2”, “Note 3” e “Note 4”. Una volta sistemato il tutto, collegando i restanti ingressi ai rispettivi moltiplicatori, il risultato sarà questo.

Per completare l'opera, rientriamo nella Macro Midi ed aggiungiamo quattro moduli Lamp – numerandoli da 1 a 4 – dal menu Panel e colleghiamoli agli ingressi della nostra Macro. In questo modo sarà facile capire, dall'interfaccia dello strumento, quali note il sequencer sta inviando.

Usciamo dalla nostra Macro ed andiamo a collegarla al Distributor/Panner, ricordandoci di tener premuto CTRL (o Cmd, se si è su Mac) per aggiungere nuove uscite al suddetto.

Come possiamo notare, nonostante abbiamo collegato tutto a dovere, nessuno dei blocchi è attivo. Questo capita quando nessuno dei moduli che utilizziamo genera un evento di default. Per ovviare a questo problema, sfrutteremo un escamotage aggiungendo un modulo Lamp che andremo a settare come Always Active dalle proprietà, sotto Function, ed invisibile disattivando il relativo parametro dalla sezione View. Il risultato sarà questo.

Spostiamoci nella sezione View delle proprietà della tabella e configuriamo come illustrato.

Diamo infine una sistemata al pannello, in modo che i controlli siano tutti in ordine.

Il sequencer è pronto, ma noi abbiamo bisogno di una sequenza genetica da caricare. Cercando sul web è possibile trovare molti database a libera consultazione che mostrano sequenze genetiche di vari organismi, da semplici batteri fino ad esseri viventi complessi come l'uomo. Troviamo qualcosa che ci aggradi ed incolliamo la sequenza in un editor di testo in modo che stia tutto sulla stessa riga e senza spazi. Ad esempio, qui di seguito una riga tratta dal genoma di una proteina del batterio Escherichia Coli:

ATCCTTAAGGAGAAAAATAATTCATATCTATCCACATTAGAAAAAATCCCATTATCTCAA

Sostituendo le lettere con dei numeri, come indicato in precedenza, seguiti da uno spazio otterremo questo

0 1 3 3 1 1 0 0 2 2 0 2 0 0 0 0 0 1 0 0 1 1 3 0 1 0 1 3 1 0 1 3 3 0 3 0 1 1 0 2 0 0 0 0 0 0 1 3 3 3 0 1 1 0 1 3 1 3 0 0

Abbiamo aggiunto gli spazi successivamente in modo che la sostituzione possa avvenire in maniera rapida e (quasi) indolore. Salviamo il file di testo come .txt (non formattato) ed importiamolo nel nostro sequencer tramite la sezione Function delle proprietà del modulo. Se il file è stato correttamente impostato, la nostra tabella mostrerà il contenuto in questo modo

Non ci resta che aprire questo strumento nella nostra DAW ed ascoltare come suonano i mattoni della vita.

A presto!

reaktor tutorial
Mostra commenti     5
Altro da leggere
Come impostare un compressore
Come riavvolgere un pickup
Segna-posizione fashion con poca spesa
Costruire uno stand per chitarra in legno
Microfonare la chitarra: scegliere il microfono e come posizionarlo
Come riparare un potenziometro rumoroso
Seguici anche su:
News
E' morto Andre Matos, storico vocalist degli Angra
Il prototipo Ibanez di Herman Li all’asta per una buona causa
Game Of Thrones suona Fender
George Gruhn sul mercato delle chitarre di oggi e di ieri
Dinah Gretsch festeggia i 40 anni nell'industria musicale
Mick Jagger sarà operato al cuore
Sono italiani gli autori del nuovo videoclip degli Stray Cats
Kleisma: la musica che nasce dal web
Un Doodle armonizza melodie sullo stile di Bach
Gibson: nominato il nuovo Director of Brand Experience
Eko festeggia 60 anni il 13 e 14 aprile
T-Rex fallisce ma promette riscatto
Spunta online il prototipo Gibson Jimi Hendrix mai giunto in produzion...
In vendita il rarissimo DS1 Golden Edition: ne esistono solo sei
Namm 2019: una giornata tipo alla fiera più grande del mondo




Licenza Creative Commons - Privacy - Accordo.it Srl - P.IVA 04265970964